After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL24 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_053095.2
Размер кДНК:546bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 24 with N terminal Flag tag.
Синоним гена:FISP, Mda7, St16, Mda-7
Виды:Mouse
переносчик:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-mIL24
Участок рестрикции:KpnI + XbaI (6kb + 0.56kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL24 Gene Plasmid Map
Mouse IL24 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51067-ACGRBS15400
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51067-ACRRBS15400
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51067-CFRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51067-CHRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51067-CMRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51067-CYRBS13340
Мышь IL-24/MDA-7 Джин клон кДНК в вектор клонированияMG51067-GRBS5130
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51067-NFRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51067-NHRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51067-NMRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51067-NYRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмидыMG51067-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin-24 (IL-24) also known as Melanoma differentiation-associated gene 7 protein (MDA-7) is a member of the IL10 family of cytokines. IL-24/MDA-7/IL24 can induce apoptosis selectively in various cancer cells. Overexpression of IL-24 leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Human IL-24/MDA-7/IL24 is secreted by activated peripheral blood mononuclear cells and is the ligand for two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. Northern blot analysis revealed IL-24/MDA-7/IL24 expression in human tissues associated with the immune system such as spleen, thymus, peripheral blood leukocytes and normal melanocytes. IL-24/MDA-7/IL24 binding to either its endogenous receptors on human keratinocytes or to ectopically expressed receptors on baby hamster kidney cells leads to activation of the signal transducers and activators of transcription.

Ссылки
  • Wang M, et al.. (2002) Interleukin 24 (MDA-7/MOB-5) signals through two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. J Biol Chem. 277(9): 7341-7.
  • Sauane M, et al.. (2003) MDA-7/IL-24: novel cancer growth suppressing and apoptosis inducing cytokine. Cytokine Growth Factor Rev. 14(1): 35-51.
  • Sarkar D, et al.. (2002) mda-7 (IL-24) Mediates selective apoptosis in human melanoma cells by inducing the coordinated overexpression of the GADD family of genes by means of p38 MAPK. Proc Natl Acad Sci U S A. 99(15): 10054-9.
  • Size / Price
    Каталог: MG51067-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse IL24 natural ORF mammalian expression plasmid, N-Flag tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».