Быстрый заказ

Text Size:AAA

Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL24 Информация о продукте «Клон cDNA»
Размер кДНК:546bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 24 with C terminal His tag.
Синоним гена:FISP, Mda7, St16, Mda-7
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51067-ACGRBS15400
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51067-ACRRBS15400
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51067-CFRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51067-CHRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51067-CMRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51067-CYRBS13340
Мышь IL-24/MDA-7 Джин клон кДНК в вектор клонированияMG51067-GRBS5130
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51067-NFRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51067-NHRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51067-NMRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51067-NYRBS13340
Мышь IL-24/MDA-7 Джин ORF экспрессии кДНК клона плазмидыMG51067-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-24 (IL-24) also known as Melanoma differentiation-associated gene 7 protein (MDA-7) is a member of the IL10 family of cytokines. IL-24/MDA-7/IL24 can induce apoptosis selectively in various cancer cells. Overexpression of IL-24 leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Human IL-24/MDA-7/IL24 is secreted by activated peripheral blood mononuclear cells and is the ligand for two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. Northern blot analysis revealed IL-24/MDA-7/IL24 expression in human tissues associated with the immune system such as spleen, thymus, peripheral blood leukocytes and normal melanocytes. IL-24/MDA-7/IL24 binding to either its endogenous receptors on human keratinocytes or to ectopically expressed receptors on baby hamster kidney cells leads to activation of the signal transducers and activators of transcription.

  • Wang M, et al.. (2002) Interleukin 24 (MDA-7/MOB-5) signals through two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. J Biol Chem. 277(9): 7341-7.
  • Sauane M, et al.. (2003) MDA-7/IL-24: novel cancer growth suppressing and apoptosis inducing cytokine. Cytokine Growth Factor Rev. 14(1): 35-51.
  • Sarkar D, et al.. (2002) mda-7 (IL-24) Mediates selective apoptosis in human melanoma cells by inducing the coordinated overexpression of the GADD family of genes by means of p38 MAPK. Proc Natl Acad Sci U S A. 99(15): 10054-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.