Быстрый заказ

Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL23A Информация о продукте «Клон cDNA»
Размер кДНК:591bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 23, alpha subunit p19 with C terminal His tag.
Синоним гена:p19, IL-23
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51086-ACGRBS15400
Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51086-ACRRBS15400
Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51086-CFRBS13340
Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51086-CHRBS13340
Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51086-CMRBS13340
Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51086-CYRBS13340
Мышь IL-23/IL-23A Джин клон кДНК в вектор клонированияMG51086-GRBS5130
Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51086-NFRBS13340
Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51086-NHRBS13340
Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51086-NMRBS13340
Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51086-NYRBS13340
Мышь IL-23/IL-23A Джин ORF экспрессии кДНК клона плазмидыMG51086-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51086-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.