After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL22 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016971.1
Размер кДНК:528bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 22 with C terminal His tag.
Синоним гена:IL-22, Iltif, IL-TIF
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51085-ACGRBS15400
Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51085-ACRRBS15400
Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51085-CFRBS13340
Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51085-CHRBS13340
Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51085-CMRBS13340
Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51085-CYRBS13340
Мышь IL22 / Interleukin 22 Джин клон кДНК в вектор клонированияMG51085-GRBS5130
Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51085-NFRBS13340
Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51085-NHRBS13340
Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51085-NMRBS13340
Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51085-NYRBS13340
Мышь IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмидыMG51085-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL22 is a member of a group of cytokines called the IL-10 family or IL-10 superfamily (including IL-19, IL-20, IL-24, and IL-26),  a class of potent mediators of cellular inflammatory responses. It shares use of IL-10R2 in cell signaling with other members of this family, IL-10, IL-26, IL-28A/B and IL-29. IL22 is produced by activated DC and T cells and initiates innate immune responses against bacterial pathogens especially in epithelial cells such as respiratory and gut epithelial cells. IL22 along with IL-17 is rapidly produced by splenic LTi-like cells and can be also produced by Th17 cells and likely plays a role in the coordinated response of both adaptive and innate immune systems.

IL22 biological activity is initiated by binding to a cell-surface complex composed of IL-22R1 and IL-10R2 receptor chains and further regulated by interactions with a soluble binding protein, IL-22BP, which shares sequence similarity with an extracellular region of IL-22R1 (sIL-22R1). IL22 and IL-10 receptor chains play a role in cellular targeting and signal transduction to selectively initiate and regulate immune responses. IL22 can contribute to immune disease through the stimulation of inflammatory responses, S100s and defensins. IL22 also promotes hepatocyte survival in the liver and epithelial cells in the lung and gut similar to IL-10. In some contexts, the pro-inflammatory versus tissue-protective functions of IL22 are regulated by the often co-expressed cytokine IL-17A.

Ссылки
  • Pestka S. et al., 2004, Annu Rev Immunol. 22: 929-79.
  • Xie MH. et al., 2000, J Biol Chem. 275 (40): 31335-9.
  • Jones BC. et al., 2008, Structure. 16 (9): 1333-44.
  • Size / Price
    Каталог: MG51085-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».