Быстрый заказ

Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь IL20RB Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001033543.3
    Размер кДНК:399bp
    Описание кДНК:Full length Clone DNA of Mus musculus interleukin 20 receptor beta with C terminal HA tag.
    Синоним гена:Fndc6, Gm186, Il20R2, AV228068, MGC130209
    Виды:Mouse
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL20RB qPCR primers for gene expression analysis, MP200500 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50507-ACGRBS15400
    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50507-ACRRBS15400
    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50507-CFRBS13340
    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50507-CHRBS13340
    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50507-CMRBS13340
    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50507-CYRBS13340
    Мышь IL20RB Джин клон кДНК в вектор клонированияMG50507-MRBS5130
    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50507-NFRBS13340
    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50507-NHRBS13340
    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50507-NMRBS13340
    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50507-NYRBS13340
    Мышь IL20RB Джин ORF экспрессии кДНК клона плазмидыMG50507-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    IL20RB belongs to the type II cytokine receptor family. There are two kinds of type II cytokine receptors : cytokine receptors that bind type I and type II interferons; cytokine receptors that bind members of the interleukin-10 family (interleukin-10, interleukin-20 and interleukin-22). Type II cytokine receptors are similar to type I cytokine receptors except they do not possess the signature sequence WSXWS that is characteristic of type I receptors. They are expressed on the surface of certain cells, which bind and respond to a select group of cytokines. These receptors are related predominantly by sequence similarities in their extracellular portions that are composed of tandem Ig-like domains. The intracellular domain of type II cytokine receptors is typically associated with a tyrosine kinase belonging to the Janus kinase (JAK) family. IL20RB and IL20RA (MIM 605620) form a heterodimeric receptor for interleukin-20.

    Ссылки
  • Zhu H, et al. (2009) Expression pattern of mda-7/IL-24 receptors in liver cancer cell lines. Hepatobiliary Pancreat Dis Int. 8(4):402-6.
  • Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5):445-51.
  • Size / Price
    Каталог: MG50507-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».