Быстрый заказ

Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL20RB Информация о продукте «Клон cDNA»
Размер кДНК:399bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 20 receptor beta with C terminal HA tag.
Синоним гена:Fndc6, Gm186, Il20R2, AV228068, MGC130209
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50507-ACGRBS15400
Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50507-ACRRBS15400
Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50507-CFRBS13340
Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50507-CHRBS13340
Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50507-CMRBS13340
Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50507-CYRBS13340
Мышь IL20RB Джин клон кДНК в вектор клонированияMG50507-MRBS5130
Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50507-NFRBS13340
Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50507-NHRBS13340
Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50507-NMRBS13340
Мышь IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50507-NYRBS13340
Мышь IL20RB Джин ORF экспрессии кДНК клона плазмидыMG50507-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

IL20RB belongs to the type II cytokine receptor family. There are two kinds of type II cytokine receptors : cytokine receptors that bind type I and type II interferons; cytokine receptors that bind members of the interleukin-10 family (interleukin-10, interleukin-20 and interleukin-22). Type II cytokine receptors are similar to type I cytokine receptors except they do not possess the signature sequence WSXWS that is characteristic of type I receptors. They are expressed on the surface of certain cells, which bind and respond to a select group of cytokines. These receptors are related predominantly by sequence similarities in their extracellular portions that are composed of tandem Ig-like domains. The intracellular domain of type II cytokine receptors is typically associated with a tyrosine kinase belonging to the Janus kinase (JAK) family. IL20RB and IL20RA (MIM 605620) form a heterodimeric receptor for interleukin-20.

  • Zhu H, et al. (2009) Expression pattern of mda-7/IL-24 receptors in liver cancer cell lines. Hepatobiliary Pancreat Dis Int. 8(4):402-6.
  • Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5):445-51.
  • Size / Price
    Каталог: MG50507-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.