IL-1 alpha / IL1A cDNA ORF Clone, Mouse, N-His tag

1/1
Price:
Size:
Number:

IL-1 alpha / IL1A cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
813 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 582C/T not causing the amino acid variation.
Description
Full length Clone DNA of Mouse interleukin 1 alpha with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.86kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-1 alpha / IL1A cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-1 alpha / IL1A cDNA ORF Clone, Mouse, N-His tag: Validated Images

IL-1 alpha / IL1A cDNA ORF Clone, Mouse, N-His tag: Alternative Names

Il-1a cDNA ORF Clone, Mouse

IL-1 alpha / IL1A Background Information

IL-1 alpha is a member of the interleukin 1 cytokine family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. Cytokines can be classified into two groups: pro- and anti-inflammatory. Pro-inflammatory cytokines, including IFNgamma, IL-1, IL-6 and TNF-alpha, are predominantly derived from the innate immune cells and Th1 cells. Anti-inflammatory cytokines, including IL-1, IL-4, IL-13 and IL-5, are synthesized from Th2 immune cells. IL-1 alpha is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. It is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. IL-1 alpha stimulates thymocyte proliferation by inducing IL-2 release, B-cell maturation and proliferation, and fibroblast growth factor activity.
Full Name
interleukin 1, alpha
References
  • Nicklin MJ,et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19(2):382-4.
  • March CJ, et al. (1985) Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature. 315(6021):641-7.
  • Bankers-Fulbright JL, et al. (1996) Interleukin-1 signal transduction. Life Sci. 59(2):61-83.
  • Dinarello CA, et al. (1997) Induction of interleukin-1 and interleukin-1 receptor antagonist. Semin Oncol. 24 (3 Suppl 9):S9-81-S9-93.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait