Быстрый заказ

Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL1A Информация о продукте «Клон cDNA»
Размер кДНК:813bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 1 alpha with N terminal His tag.
Синоним гена:Il-1a
Участок рестрикции:KpnI + XbaI (6kb + 0.86kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 582C/T not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL1A Gene Plasmid Map
Mouse IL1F1 / IL1α natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50114-ACGRBS15400
Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50114-ACRRBS15400
Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50114-CFRBS13340
Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50114-CHRBS13340
Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50114-CMRBS13340
Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50114-CYRBS13340
Мышь IL1A/IL-1A/IL-1F1 Джин клон кДНК в вектор клонированияMG50114-MRBS5130
Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50114-NFRBS13340
Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50114-NHRBS13340
Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50114-NMRBS13340
Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50114-NYRBS13340
Мышь IL1A/IL-1A/IL-1F1 Джин ORF экспрессии кДНК клона плазмидыMG50114-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

IL-1 alpha is a member of the interleukin 1 cytokine family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. Cytokines can be classified into two groups: pro- and anti-inflammatory. Pro-inflammatory cytokines, including IFNgamma, IL-1, IL-6 and TNF-alpha, are predominantly derived from the innate immune cells and Th1 cells. Anti-inflammatory cytokines, including IL-10, IL-4, IL-13 and IL-5, are synthesized from Th2 immune cells. IL-1 alpha is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. It is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. IL-1 alpha stimulates thymocyte proliferation by inducing IL-2 release, B-cell maturation and proliferation, and fibroblast growth factor activity.

  • Nicklin MJ,et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19(2):382-4.
  • March CJ, et al. (1985) Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature. 315(6021):641-7.
  • Bankers-Fulbright JL, et al. (1996) Interleukin-1 signal transduction. Life Sci. 59(2):61-83.
  • Dinarello CA, et al. (1997) Induction of interleukin-1 and interleukin-1 receptor antagonist. Semin Oncol. 24 (3 Suppl 9):S9-81-S9-93.
  • Size / Price
    Каталог: MG50114-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Mouse IL1F1 / IL1α natural ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.