Быстрый заказ

Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL18BP Информация о продукте «Клон cDNA»
Размер кДНК:582bp
Описание кДНК:Full length Clone DNA of Mus musculus Interleukin 18 binding protein with N terminal Myc tag.
Синоним гена:MC54L, Igifbp, IL-18BP
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50206-ACGRBS15400
Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50206-ACRRBS15400
Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50206-CFRBS13340
Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50206-CHRBS13340
Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50206-CMRBS13340
Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50206-CYRBS13340
Мышь IL18BP / IL18BPa Джин клон кДНК в вектор клонированияMG50206-MRBS5130
Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50206-NFRBS13340
Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50206-NHRBS13340
Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50206-NMRBS13340
Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50206-NYRBS13340
Мышь IL18BP / IL18BPa Джин ORF экспрессии кДНК клона плазмидыMG50206-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-18-binding protein (IL-18BP) is a constitutively expressed and secreted protein. IL-18BP is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. The adjacently located family members IL18 Receptor 1 (IL18R1) and IL18 receptor accessory protein (IL18RAP) may also be important in the development of asthma and atopy. IL-18 binding protein (IL-18BP) was only moderately elevated, resulting in a high level of biologically active free IL-18 in HPS. A severe IL-18/IL-18BP imbalance results in Th-1 lymphocyte and macrophage activation, which escapes control by NK-cell cytotoxicity and may allow for secondary HPS in patients with underlying diseases.

  • Novick D, et al.. (2001) A novel IL-18BP ELISA shows elevated serum IL-18BP in sepsis and extensive decrease of free IL-18. Cytokine. 14(6): 334-42.
  • Mazodier K, et al.. (2005) Severe imbalance of IL-18/IL-18BP in patients with secondary hemophagocytic syndrome. Blood. 106(10): 3483-9.
  • Akira S. (2000) The role of IL-18 in innate immunity. Curr Opin Immunol. 12(1): 59-63.
  • Size / Price
    Каталог: MG50206-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.