Быстрый заказ

Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь IL17RA Информация о продукте «Клон cDNA»
    Размер кДНК:2595bp
    Описание кДНК:Full length Clone DNA of Mus musculus interleukin 17 receptor A with C terminal Myc tag.
    Синоним гена:Il17r, Cdw217, VDw217, AW538159, Il17ra
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with IL17RA qPCR primers for gene expression analysis, MP200351 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50328-ACGRBS22240
    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50328-ACRRBS22240
    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50328-CFRBS20190
    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50328-CHRBS20190
    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50328-CMRBS20190
    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50328-CYRBS20190
    Мышь IL17RA/IL-17RA/CD217 Джин клон кДНК в вектор клонированияMG50328-MRBS5130
    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50328-NFRBS20190
    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50328-NHRBS20190
    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50328-NMRBS20190
    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50328-NYRBS20190
    Мышь IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмидыMG50328-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Interleukin-17 receptor (IL-17R), also known as Interleukin-17 receptor A (IL-17RA) and CD217 antigen (CD217), is a cytokine receptor which binds interleukin 17. IL-17R/IL-17RA (CD217) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. IL-17R/IL-17RA (CD217) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor IL-17RA play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Defects in IL-17R/IL-17RA (CD217) are the cause of familial candidiasis type 5 (CANDF5). CANDF5 is a rare disorder with altered immune responses and impaired clearance of fungal infections, selective against Candida. It is characterized by persistent and/or recurrent infections of the skin, nails and mucous membranes caused by organisms of the genus Candida, mainly Candida albicans.

  • Gaffen SL. (2009) Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 9 (8): 556-67.
  • Johansen C, et al.. (2009) Characterization of the interleukin-17 isoforms and receptors in lesional psoriatic skin. Br J Dermatol. 160 (2): 319-24.
  • Yao Z, et al.. (1997) Molecular characterization of the human interleukin (IL)-17 receptor. Cytokine 9 (11): 794-800.
  • Size / Price
    Каталог: MG50328-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.