Быстрый заказ

Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь IL17D Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_145837.3
Размер кДНК:618bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 17 D with N terminal His tag.
Синоним гена:Il27a, IL-17D, AI462269
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL17D qPCR primers for gene expression analysis, MP200138 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50108-ACGRBS15400
Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50108-ACRRBS15400
Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50108-CFRBS13340
Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50108-CHRBS13340
Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50108-CMRBS13340
Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50108-CYRBS13340
Мышь IL-17D/IL17D Джин клон кДНК в вектор клонированияMG50108-MRBS5130
Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50108-NFRBS13340
Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50108-NHRBS13340
Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50108-NMRBS13340
Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50108-NYRBS13340
Мышь IL-17D/IL17D Джин ORF экспрессии кДНК клона плазмидыMG50108-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50108-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».