After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL17A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010552.3
Размер кДНК:468bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 17A with N terminal Flag tag.
Синоним гена:Il17, Ctla8, Ctla-8
Виды:Mouse
переносчик:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-mIL17A
Участок рестрикции:KpnI + XbaI (6kb + 0.49kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL17A Gene Plasmid Map
Mouse IL17A natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51065-ACGRBS15396
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51065-ACRRBS15396
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51065-CFRBS13343
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51065-CHRBS13343
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51065-CMRBS13343
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51065-CYRBS13343
Мышь IL17A/IL-17A/IL17 Джин клон кДНК в вектор клонированияMG51065-GRBS5132
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51065-NFRBS13343
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51065-NHRBS13343
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51065-NMRBS13343
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51065-NYRBS13343
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмидыMG51065-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL17, also known as IL17a, is a cytokine belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. The IL-17 family of cytokines includes six members, IL-17/IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and IL-17F, which are produced by multiple cell types. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of IL-17 are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis.

Ссылки
  • Andoh A, et al. (2002) IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 169(4):1683-7.
  • Kotake S, et al. (1999) IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 103(9):1345-52.
  • Laan M, et al. (1999) Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol. 162(4):2347-52.
  • Shin HC, et al. (1999) Regulation of IL-17, IFN-gamma and IL-10 in human CD8(+) T cells by cyclic AMP-dependent signal transduction pathway. Cytokine. 10(11):841-50.
  • Size / Price
    Каталог: MG51065-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse IL17A natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».