After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL17A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010552.3
Размер кДНК:468bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 17A with C terminal His tag.
Синоним гена:Il17, Ctla8, Ctla-8
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51065-ACGRBS15400
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51065-ACRRBS15400
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51065-CFRBS13340
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51065-CHRBS13340
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51065-CMRBS13340
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51065-CYRBS13340
Мышь IL17A/IL-17A/IL17 Джин клон кДНК в вектор клонированияMG51065-GRBS5130
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51065-NFRBS13340
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51065-NHRBS13340
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51065-NMRBS13340
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51065-NYRBS13340
Мышь IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмидыMG51065-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL17, also known as IL17a, is a cytokine belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. The IL-17 family of cytokines includes six members, IL-17/IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and IL-17F, which are produced by multiple cell types. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of IL-17 are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis.

Ссылки
  • Andoh A, et al. (2002) IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 169(4):1683-7.
  • Kotake S, et al. (1999) IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 103(9):1345-52.
  • Laan M, et al. (1999) Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol. 162(4):2347-52.
  • Shin HC, et al. (1999) Regulation of IL-17, IFN-gamma and IL-10 in human CD8(+) T cells by cyclic AMP-dependent signal transduction pathway. Cytokine. 10(11):841-50.
  • Size / Price
    Каталог: MG51065-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».