Быстрый заказ

Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь IL11 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_008350.2
    Размер кДНК:600bp
    Описание кДНК:Full length Clone DNA of Mus musculus interleukin 11 with N terminal His tag.
    Синоним гена:IL-11
    Виды:Mouse
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL11 qPCR primers for gene expression analysis, MP200147 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50117-ACGRBS15400
    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50117-ACRRBS15400
    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50117-CFRBS13340
    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50117-CHRBS13340
    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50117-CMRBS13340
    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50117-CYRBS13340
    Мышь IL-11 / interleukin 11 Джин клон кДНК в вектор клонированияMG50117-MRBS5130
    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50117-NFRBS13340
    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50117-NHRBS13340
    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50117-NMRBS13340
    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50117-NYRBS13340
    Мышь IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмидыMG50117-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    IL11 is a multifunctional cytokine first isolated in 1990 from bone marrow-derived stromal cells. It is a key regulator of multiple events in hematopoiesis, most notably the stimulation of megakaryocyte maturation. IL11 is also known under the names adipogenesis inhibitory factor (AGIF) and oprelvekin. IL11 can improve platelet recovery after chemotherapy-induced thrombocytopenia, induce acute phase proteins, modulate antigen-antibody responses, participate in the regulation of bone cell proliferation and differentiation and could be use as a therapeutic for osteoporosis. IL11 stimulates the growth of certain lymphocytes and, in the murine model, stimulates an increase in the cortical thickness and strength of long bones. As a signaling molecule, IL11 has a variety of functions associated with its receptor interleukin 11 receptor alpha; such functions include placentation and to some extent of decidualization.

    Ссылки
  • McKinley D. et al., 1992, Genomics. 13 (3): 814-9.
  • Paul SR. et al., 1990, Proc Natl Acad Sci. 87 (19): 7512-6.
  • Kawashima I. et al., 1991, FEBS Lett. 283 (2): 199-202.
  • Size / Price
    Каталог: MG50117-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».