After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IGSF21 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_198610.2
Размер кДНК:1407bp
Описание кДНК:Full length Clone DNA of Mus musculus immunoglobulin superfamily, member 21 with C terminal HA tag.
Синоним гена:Gm141, BC055811
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51776-ACGRBS15396
Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51776-ACRRBS15396
Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51776-CFRBS13343
Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51776-CHRBS13343
Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51776-CMRBS13343
Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51776-CYRBS13343
Мышь IGSF21 Джин клон кДНК в вектор клонированияMG51776-GRBS5132
Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51776-NFRBS13343
Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51776-NHRBS13343
Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51776-NMRBS13343
Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51776-NYRBS13343
Мышь IGSF21 Джин ORF экспрессии кДНК клона плазмидыMG51776-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51776-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».