Быстрый заказ

Text Size:AAA

Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IGFBP6 Информация о продукте «Клон cDNA»
Размер кДНК:717bp
Описание кДНК:Full length Clone DNA of Mus musculus insulin-like growth factor binding protein 6 with N terminal Flag tag.
Синоним гена:IGFBP-6, Igfbp6
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50460-ACGRBS15400
Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50460-ACRRBS15400
Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50460-CFRBS13340
Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50460-CHRBS13340
Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50460-CMRBS13340
Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50460-CYRBS13340
Мышь IGFBP6 / IBP6 Джин клон кДНК в вектор клонированияMG50460-MRBS5130
Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50460-NFRBS13340
Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50460-NHRBS13340
Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50460-NMRBS13340
Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50460-NYRBS13340
Мышь IGFBP6 / IBP6 Джин ORF экспрессии кДНК клона плазмидыMG50460-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Insulin-like growth factor binding protein 6 (IGFBP6) is a 24-kDa protein that binds insulin-like growth factor 1 (IGF-1) and IGF-2 with high affinity and inhibits IGF action in vitro. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGF-binding protein-4 (IGFBP-4) inhibits IGF-I action in vitro and is the most abundant IGFBP in the rodent arterial wall. IGFBP6 is directly downregulated by the beta-catenin/TCF complex in desmoid tumors, and imply a role for the IGF axis in the proliferation of desmoid tumors. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.

  • Denys H, et al. (2004) Identification of IGFBP-6 as a significantly downregulated gene by beta-catenin in desmoid tumors. Oncogene. 23(3): 654-64.
  • Bach LA. Insulin-like growth factor binding protein-6: the "forgotten" binding protein? Horm Metab Res. 31(2-3): 226-34.
  • Bach LA. IGFBP-6 five years on; not so 'forgotten'? Growth Horm IGF Res. 15(3): 185-92.
  • Size / Price
    Каталог: MG50460-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.