Быстрый заказ

Text Size:AAA

Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IGFBP5 Информация о продукте «Клон cDNA»
Размер кДНК:816bp
Описание кДНК:Full length Clone DNA of Mus musculus insulin-like growth factor binding protein 5 with C terminal His tag.
Синоним гена:IGFBP-5, AI256729, AW208790, IGFBP-5P, Igfbp5
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50444-ACGRBS15396
Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50444-ACRRBS15400
Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50444-CFRBS13343
Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50444-CHRBS13343
Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50444-CMRBS13343
Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50444-CYRBS13343
Мышь IGFBP5 / IGFBP-5 Джин клон кДНК в вектор клонированияMG50444-MRBS5132
Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50444-NFRBS13343
Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50444-NHRBS13340
Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50444-NMRBS13343
Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50444-NYRBS13343
Мышь IGFBP5 / IGFBP-5 Джин ORF экспрессии кДНК клона плазмидыMG50444-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50444-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.