After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IGBP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008784.3
Размер кДНК:1023bp
Описание кДНК:Full length Clone DNA of Mus musculus immunoglobulin (CD79A) binding protein 1 with N terminal His tag.
Синоним гена:p52, Pc52, Tap42, C81413, AI115586, AI662457, AW208785
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51389-ACGRBS15396
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51389-ACRRBS15400
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51389-ANGRBS15396
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51389-ANRRBS15400
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51389-CFRBS13343
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51389-CHRBS13343
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51389-CMRBS13340
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51389-CYRBS13343
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51389-NFRBS13343
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51389-NHRBS13343
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51389-NMRBS13343
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51389-NYRBS13343
Мышь IGBP1 Джин клон кДНК в вектор клонированияMG51389-URBS5132
Мышь IGBP1 Джин ORF экспрессии кДНК клона плазмидыMG51389-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51389-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».