Быстрый заказ

Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IFT52 Информация о продукте «Клон cDNA»
Размер кДНК:1281bp
Описание кДНК:Full length Clone DNA of Mus musculus intraflagellar transport 52 with C terminal His tag.
Синоним гена:NGD5, BC037708
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG53050-ACGRBS15400
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG53050-ACRRBS15400
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG53050-ANGRBS15400
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG53050-ANRRBS15400
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG53050-CFRBS13340
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG53050-CHRBS13340
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG53050-CMRBS13340
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG53050-CYRBS13340
Мышь IFT52 Джин клон кДНК в вектор клонированияMG53050-GRBS5130
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG53050-NFRBS13340
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG53050-NHRBS13340
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG53050-NMRBS13340
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG53050-NYRBS13340
Мышь IFT52 Джин ORF экспрессии кДНК клона плазмидыMG53050-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.