Быстрый заказ

Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IFNAR1 Информация о продукте «Клон cDNA»
Размер кДНК:1773bp
Описание кДНК:Full length Clone DNA of Mus musculus interferon (alpha and beta) receptor 1 with C terminal His tag.
Синоним гена:Ifar, Ifrc, CD118, Ifnar, Infar, Ifnar1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50469-ACGRBS16760
Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50469-ACRRBS16760
Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50469-CFRBS14710
Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50469-CHRBS14710
Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50469-CMRBS14710
Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50469-CYRBS14710
Мышь IFNAR1 Джин клон кДНК в вектор клонированияMG50469-MRBS5130
Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50469-NFRBS14710
Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50469-NHRBS14710
Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50469-NMRBS14710
Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50469-NYRBS14710
Мышь IFNAR1 Джин ORF экспрессии кДНК клона плазмидыMG50469-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interferon-alpha/beta receptor alpha chain (IFNAR1) is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. Tyk2 slows down IFNAR1 degradation and that this is due, at least in part, to inhibition of IFNAR1 endocytosis. Mutant versions of IFNAR1, in which Tyr466 is changed to phenylalanine, can act in a dominant negative manner to inhibit phosphorylation of STAT2. These observations are consistent with a model in which IFNAR1 mediates the interaction between JAK kinases and the STAT transcription factors.

  • Yan H, et al. (1996) Phosphorylated interferon-alpha receptor 1 subunit (IFNaR1) acts as a docking site for the latent form of the 113 kDa STAT2 protein. EMBO J. 15(5): 1064-74.
  • Richter MF, et al. (1998) Specific contribution of Tyk2 JH regions to the binding and the expression of the interferon alpha/beta receptor component IFNAR1. J Biol Chem. 273(38): 24723-9.
  • Abramovich C, et al. (1997) A protein-arginine methyltransferase binds to the intracytoplasmic domain of the IFNAR1 chain in the type I interferon receptor. EMBO J. 16(2): 260-6.
  • Size / Price
    Каталог: MG50469-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.