Быстрый заказ

Text Size:AAA

Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IDH1 Информация о продукте «Клон cDNA»
Размер кДНК:1245bp
Описание кДНК:Full length Clone DNA of Mus musculus isocitrate dehydrogenase 1 (NADP+), soluble with N terminal Flag tag.
Синоним гена:Id-1, Idpc, Idh-1, AI314845, AI788952, E030024J03Rik
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52936-ACGRBS15400
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52936-ACRRBS15400
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52936-ANGRBS15400
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52936-ANRRBS15400
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52936-CFRBS13340
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52936-CHRBS13340
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52936-CMRBS13340
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52936-CYRBS13340
Мышь IDH1 Джин клон кДНК в вектор клонированияMG52936-GRBS5130
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52936-NFRBS13340
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52936-NHRBS13340
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52936-NMRBS13340
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52936-NYRBS13340
Мышь IDH1 Джин ORF экспрессии кДНК клона плазмидыMG52936-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Takano S, et al. (2011) Detection of IDH1 mutation in human gliomas: comparison of immunohistochemistry and sequencing. Brain Tumor Pathol. 28(2): 115-23.
  • Geisbrecht BV, et al. (1999) The human PICD gene encodes a cytoplasmic and peroxisomal NADP(+)-dependent isocitrate dehydrogenase. J Biol Chem. 274(43): 30527-30533.
  • Nekrutenko A, et al. (1998) Cytosolic isocitrate dehydrogenase in humans, mice, and voles and phylogenetic analysis of the enzyme family. Mol Biol Evol. 15(12): 1674-1684.
  • Henke B, et al. (1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids. J Biol Chem. 273(6): 3702-3711.
  • Gabriel JL, et al. (1986) Activity of purified NAD-specific isocitrate dehydrogenase at modulator and substrate concentrations approximating conditions in mitochondria. Metabolism. 35(7): 661-667.
  • Size / Price
    Каталог: MG52936-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.