After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse HSPA8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_031165
Размер кДНК:1941bp
Описание кДНК:Full length Clone DNA of Mus musculus heat shock protein 8 with C terminal HA tag.
Синоним гена:Hsc70; Hsc71; Hsc73; Hsp73; Hspa10; 2410008N15Rik
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51191-ACGRBS16760
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51191-ACRRBS16764
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51191-ANGRBS16760
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51191-ANRRBS16764
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51191-CFRBS14710
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51191-CHRBS14710
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51191-CMRBS14711
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51191-CYRBS14710
Мышь HSPA8/HSC70 Джин клон кДНК в вектор клонированияMG51191-GRBS4380
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51191-NFRBS14710
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51191-NHRBS14711
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51191-NMRBS14711
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51191-NYRBS14710
Мышь HSPA8/HSC70 Джин клон кДНК в вектор клонированияMG51191-URBS5132
Мышь HSPA8/HSC70 Джин ORF экспрессии кДНК клона плазмидыMG51191-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

HSPA8, also known as HSC70, is a member of the heat shock protein family due to homology with other heat shock proteins. The heat shock protein 70 family is comprised by both heat-inducible and constitutively expressed members. The latter are called heat-shock cognate proteins. HSPA8 belongs to the heat-shock cognate subgroup. Members of the human heat-shock protein multigene family have several highly conserved proteins with structural and functional properties in common, but vary in the extent of their inducibility in response to metabolic stress. HSPA8 is constitutively expressed and performs functions related to normal cellular processes. This protein binds to nascent polypeptides to facilitate correct protein folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Two alternatively spliced variants have been characterized to date. HSPA8 acts as a repressor of transcriptional activation. It inhibits the transcriptional coactivator activity of CITED1 on Smad-mediated transcription. Isoform 2 may function as an endogenous inhibitory regulator of HSC70 by competing the co-chaperones. It also is a ATPase that works with auxilin to remove clathrin coated vesicles. In neurons, synaptojanin is also an important protein involved in vesicle uncoating.

Ссылки
  • Santacruz H, et al. (1997) Molecular characterization of a heat shock cognate cDNA of zebrafish, hsc70, and developmental expression of the corresponding transcripts. Dev Genet. 21:223-33.
  • Harhay G P, et al. (2005) Characterization of 954 bovine full-CDS cDNA sequences. BMC Genomics. 6: 166.
  • Goldfarb S, et al. (2006) Differential effects of Hsc70 and Hsp70 on the intracellular trafficking and functional expression of epithelial sodium channels. Proc Natl Acad Sci. 103(15):5817-22.
  • Size / Price
    Каталог: MG51191-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».