Hsp90 alpha / HSP90AA1 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

Hsp90 alpha / HSP90AA1 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2202 bp
Description
Full length Clone DNA of Mouse heat shock protein 90, alpha (cytosolic), class A member 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Hsp90 alpha / HSP90AA1 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

86kDa cDNA ORF Clone, Mouse; 89kDa cDNA ORF Clone, Mouse; AL024080 cDNA ORF Clone, Mouse; AL024147 cDNA ORF Clone, Mouse; hsp4 cDNA ORF Clone, Mouse; Hsp86-1 cDNA ORF Clone, Mouse; Hsp89 cDNA ORF Clone, Mouse; Hsp90 cDNA ORF Clone, Mouse; Hspca cDNA ORF Clone, Mouse

Hsp90 alpha / HSP90AA1 Background Information

Heat shock protein 9 (9 kDa heat-shock protein, HSP9) is a molecular chaperone involved in the trafficking of proteins in the cell. It is a remarkably versatile protein involved in the stress response and in normal homoeostatic control mechanisms. HSP9 interacts with 'client proteins', including protein kinases, transcription factors and others, and either facilitates their stabilization and activation or directs them for proteasomal degradation. By this means, HSP9 displays a multifaceted ability to influence signal transduction, chromatin remodelling and epigenetic regulation, development and morphological evolution. HSP9 operates as a dimer in a conformational cycle driven by ATP binding and hydrolysis at the N-terminus. Disruption of HSP9 leads to client protein degradation and often cell death. Under stressful conditions, HSP9 stabilizes its client proteins and provides protection to the cell against cellular stressors such as in cancer cells. Especially, several oncoproteins act as HSP9 client proteins and tumor cells require higher HSP9 activity than normal cells to maintain their malignancy. For this reason, Hsp9 has emerged as a promising target for anti-cancer drug development.
Full Name
heat shock protein 90kDa alpha (cytosolic), class A member 1
References
  • Pearl LH, et al. (2008) The Hsp90 molecular chaperone: an open and shut case for treatment. Biochem J. 410(3): 439-53.
  • Hahn JS. (2009) The Hsp90 chaperone machinery: from structure to drug development. BMB Rep. 42(10): 623-30.
  • Holzbeierlein JM, et al. (2010) Hsp90: a drug target? Curr Oncol Rep. 12(2): 95-101.
  • Trepel J, et al. (2010) Targeting the dynamic HSP90 complex in cancer. Nat Rev Cancer. 10(8): 537-49.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait