After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse HSP90AA1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC046614.1
Размер кДНК:2202bp
Описание кДНК:Full length Clone DNA of Mus musculus heat shock protein 90, alpha (cytosolic), class A member 1 with N terminal HA tag.
Синоним гена:hsp4, 86kDa, 89kDa, Hsp89, Hsp90, Hspca, Hsp86-1, AL024080, AL024147
Виды:Mouse
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51995-ACGRBS16764
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51995-ACGRBS16764
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51995-ACRRBS16764
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51995-ANGRBS16764
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51995-ANRRBS16764
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51995-CFRBS14711
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51995-CHRBS14711
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51995-CMRBS14711
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51995-CYRBS14711
Мышь HSP90/HSP90AA1 Джин клон кДНК в вектор клонированияMG51995-GRBS5132
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51995-NFRBS14711
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51995-NHRBS14711
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51995-NMRBS14711
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51995-NYRBS14711
Мышь HSP90/HSP90AA1 Джин ORF экспрессии кДНК клона плазмидыMG51995-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Heat shock protein 90 (90 kDa heat-shock protein, HSP90) is a molecular chaperone involved in the trafficking of proteins in the cell. It is a remarkably versatile protein involved in the stress response and in normal homoeostatic control mechanisms. HSP90 interacts with 'client proteins', including protein kinases, transcription factors and others, and either facilitates their stabilization and activation or directs them for proteasomal degradation. By this means, HSP90 displays a multifaceted ability to influence signal transduction, chromatin remodelling and epigenetic regulation, development and morphological evolution. HSP90 operates as a dimer in a conformational cycle driven by ATP binding and hydrolysis at the N-terminus. Disruption of HSP90 leads to client protein degradation and often cell death. Under stressful conditions, HSP90 stabilizes its client proteins and provides protection to the cell against cellular stressors such as in cancer cells. Especially, several oncoproteins act as HSP90 client proteins and tumor cells require higher HSP90 activity than normal cells to maintain their malignancy. For this reason, Hsp90 has emerged as a promising target for anti-cancer drug development.

Ссылки
  • Pearl LH, et al. (2008) The Hsp90 molecular chaperone: an open and shut case for treatment. Biochem J. 410(3): 439-53.
  • Hahn JS. (2009) The Hsp90 chaperone machinery: from structure to drug development. BMB Rep. 42(10): 623-30.
  • Holzbeierlein JM, et al. (2010) Hsp90: a drug target? Curr Oncol Rep. 12(2): 95-101.
  • Trepel J, et al. (2010) Targeting the dynamic HSP90 complex in cancer. Nat Rev Cancer. 10(8): 537-49.
  • Size / Price
    Каталог: MG51995-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».