After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse HPX Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_017371.2
Размер кДНК:1383bp
Описание кДНК:Full length Clone DNA of Mus musculus hemopexin.
Синоним гена:hx, Hpxn, Hpx
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50271-ACGRBS15400
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50271-ACRRBS15400
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50271-CFRBS13340
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50271-CHRBS13340
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50271-CMRBS13340
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50271-CYRBS13340
Мышь Hemopexin Джин клон кДНК в вектор клонированияMG50271-MRBS5130
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50271-NFRBS13340
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50271-NHRBS13340
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50271-NMRBS13340
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50271-NYRBS13340
Мышь Hemopexin Джин ORF экспрессии кДНК клона плазмидыMG50271-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50271-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».