After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse HOOK1 Информация о продукте «Клон cDNA»
Размер кДНК:2187bp
Описание кДНК:Full length Clone DNA of Mus musculus hook homolog 1 (Drosophila) with N terminal Myc tag.
Синоним гена:azh, A930033L17Rik
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52584-ACGRBS16764
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52584-ACRRBS16764
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52584-ANGRBS16764
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52584-ANRRBS16764
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52584-CFRBS14711
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52584-CHRBS14711
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52584-CMRBS14711
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52584-CYRBS14711
Мышь HOOK1 Джин клон кДНК в вектор клонированияMG52584-GRBS5132
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52584-NFRBS14711
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52584-NHRBS14711
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52584-NMRBS14711
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52584-NYRBS14711
Мышь HOOK1 Джин ORF экспрессии кДНК клона плазмидыMG52584-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52584-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.