After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse HNRNPC Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001170983.1
Размер кДНК:882bp
Описание кДНК:Full length Clone DNA of Mus musculus heterogeneous nuclear ribonucleoprotein C with N terminal Flag tag.
Синоним гена:Hnrpc, Hnrpc1, Hnrpc2, hnRNPC1, hnRNPC2, hnrnp-C, AL022939, D14Wsu171e
Виды:Mouse
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51852-ACGRBS15396
Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51852-ACRRBS15396
Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51852-CFRBS13343
Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51852-CHRBS13343
Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51852-CMRBS13343
Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51852-CYRBS13343
Мышь HNRNPC Джин клон кДНК в вектор клонированияMG51852-GRBS5132
Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51852-NFRBS13343
Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51852-NHRBS13343
Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51852-NMRBS13343
Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51852-NYRBS13343
Мышь HNRNPC Джин ORF экспрессии кДНК клона плазмидыMG51852-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51852-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».