Быстрый заказ

Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь HN1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_008258.1
    Размер кДНК:465bp
    Описание кДНК:Full length Clone DNA of Mus musculus hematological and neurological expressed sequence 1.
    Синоним гена:RP23-392H19.9, Hn1
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HN1 qPCR primers for gene expression analysis, MP201236 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51359-ACGRBS15400
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51359-ACRRBS15400
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51359-ANGRBS15400
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51359-ANRRBS15400
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51359-CFRBS13340
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51359-CHRBS13340
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51359-CMRBS13340
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51359-CYRBS13340
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51359-NFRBS13340
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51359-NHRBS13340
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51359-NMRBS13340
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51359-NYRBS13340
    Мышь HN-1 / ARM2 Джин клон кДНК в вектор клонированияMG51359-URBS5130
    Мышь HN-1 / ARM2 Джин ORF экспрессии кДНК клона плазмидыMG51359-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51359-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».