Быстрый заказ

Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь HID1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AK044395.1
Размер кДНК:2364bp
Описание кДНК:Full length Clone DNA of Mus musculus HID1 domain containing.
Синоним гена:C630004H02Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with HID1 qPCR primers for gene expression analysis, MP201261 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51388-ACGRBS16760
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51388-ACRRBS16760
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51388-ANGRBS16760
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51388-ANRRBS16760
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51388-CFRBS14710
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51388-CHRBS14710
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51388-CMRBS14710
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51388-CYRBS14710
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51388-NFRBS14710
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51388-NHRBS14710
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51388-NMRBS14710
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51388-NYRBS14710
Мышь HID1/C17orf28 Джин клон кДНК в вектор клонированияMG51388-URBS5130
Мышь HID1/C17orf28 Джин ORF экспрессии кДНК клона плазмидыMG51388-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51388-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».