After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse HDHD2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_029826.2
Размер кДНК:780bp
Описание кДНК:Full length Clone DNA of Mus musculus haloacid dehalogenase-like hydrolase domain containing 2 with N terminal Myc tag.
Синоним гена:0610039H12Rik; 3110052N05Rik
Виды:Mouse
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52030-ACGRBS15396
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52030-ACRRBS15396
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52030-ANGRBS15396
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52030-ANRRBS15396
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52030-CFRBS13343
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52030-CHRBS13343
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52030-CMRBS13343
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52030-CYRBS13343
Мышь HDHD2 Джин клон кДНК в вектор клонированияMG52030-GRBS5132
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52030-NFRBS13343
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52030-NHRBS13343
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52030-NMRBS13343
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52030-NYRBS13343
Мышь HDHD2 Джин ORF экспрессии кДНК клона плазмидыMG52030-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52030-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».