After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse HDAC8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_027382.3
Размер кДНК:1134bp
Описание кДНК:Full length Clone DNA of Mus musculus histone deacetylase 8.
Синоним гена:2610007D20Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50273-ACGRBS15400
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50273-ACRRBS15400
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50273-ANGRBS15400
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50273-ANRRBS15400
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50273-CFRBS13340
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50273-CHRBS13340
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50273-CMRBS13340
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50273-CYRBS13340
Мышь HDAC8 Джин клон кДНК в вектор клонированияMG50273-MRBS5130
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50273-NFRBS13340
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50273-NHRBS13340
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50273-NMRBS13340
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50273-NYRBS13340
Мышь HDAC8 Джин ORF экспрессии кДНК клона плазмидыMG50273-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Histone deacetylase 8, also known as HDAC8 and HDACL1, is a nucleus and cytoplasm protein which belongs to the histone deacetylase family and HD type 1 subfamily. Histone deacetylases (HDACs) are a growing family of enzymes implicated in transcriptional regulation by affecting the acetylation state of core histones in the nucleus of cells. HDAC8 / HDACL1 is weakly expressed in most tissues. It expressed at higher level in heart, brain, kidney and pancreas and also in liver, lung, placenta, prostate and kidney. HDAC8 / HDACL1 is responsible for the deacetylation of lysine residues on the N-terminal part of the core histones ( H2A, H2B, H3 and H4 ). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. HDAC8 / HDACL1 may play a role in smooth muscle cell contractility. HDAC8 / HDACL1 may be a potential drug target for neuroblastoma differentiation therapy using selective inhibitors, avoiding unspecific side effects.

Ссылки
  • Buggy JJ. et al.,2000, Biochem J. 350 (1): 199-205.
  • Krennhrubec K. et al., 2007, Bioorg Med Chem Lett. 17 (10): 2874-8.
  • Oehme I. et al., 2009, Expert Opin Investig Drugs.18 (11): 1605-17.
  • Size / Price
    Каталог: MG50273-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».