After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse HBA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008218.2
Размер кДНК:429bp
Описание кДНК:Full length Clone DNA of Mus musculus hemoglobin alpha, adult chain 1.
Синоним гена:Hba, Hba1, Hbat1
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51345-ACGRBS15396
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51345-ACRRBS15396
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51345-ANGRBS15396
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51345-ANRRBS15396
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51345-CFRBS13343
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51345-CHRBS13343
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51345-CMRBS13343
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51345-CYRBS13343
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51345-NFRBS13343
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51345-NHRBS13343
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51345-NMRBS13343
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51345-NYRBS13343
Мышь HBA/alpha-hemoglobin Джин клон кДНК в вектор клонированияMG51345-URBS5132
Мышь HBA/alpha-hemoglobin Джин ORF экспрессии кДНК клона плазмидыMG51345-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51345-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».