After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse HAVCR1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_134248.1
Размер кДНК:918bp
Описание кДНК:Full length Clone DNA of Mus musculus hepatitis A virus cellular receptor 1 with C terminal Myc tag.
Синоним гена:Tim1, TIM-1, Timd1, AI503787, Havcr1
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50321-ACGRBS15400
Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50321-ACRRBS15400
Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50321-CFRBS13340
Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50321-CHRBS13340
Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50321-CMRBS13340
Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50321-CYRBS13340
Мышь TIM-1/KIM-1/HACVR Джин клон кДНК в вектор клонированияMG50321-MRBS5130
Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50321-NFRBS13340
Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50321-NHRBS13340
Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50321-NMRBS13340
Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50321-NYRBS13340
Мышь TIM-1/KIM-1/HACVR Джин ORF экспрессии кДНК клона плазмидыMG50321-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Human HAV cellular receptor 1 (HAVCR1), also known as Kidney injury molecule 1 (KIM-1) and T cell immunoglobulinmucin 1 (TIM-1), is a type â…  integral membrane glycoprotein. KIM-1 protein is widely expressed with highest levels in kidney and testis. It has been shown to play a major role as a human susceptibility gene for asthma, allergy and autoimmunity. IgA1lambda is a specific ligand of KIM-1 protein and that their association has a synergistic effect in virus-receptor interactions. KIM-1 involves in the pathogenesis of acute kidney injury. It had been confirmed that KIM-1 is a human urinary renal dysfunction biomarker. Moreover, KIM-1 protein is a novel regulatory molecule of flow-induced calcium signaling.

Ссылки
  • Tami C, et al. (2007) Immunoglobulin A (IgA) is a natural ligand of hepatitis A virus cellular receptor 1 (HAVCR1), and the association of IgA with HAVCR1 enhances virus-receptor interactions. J Virol. 81(7): 3437-46.
  • Rees AJ, et al. (2008) Kim-1/Tim-1: from biomarker to therapeutic target? Nephrol Dial Transplant. 23(11): 3394-6.
  • Chaturvedi S, et al. (2009) Assay validation for KIM-1: human urinary renal dysfunction biomarker. Int J Biol Sci. 5(2): 128-34.
  • Size / Price
    Каталог: MG50321-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».