KAT1 / HAT1 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

KAT1 / HAT1 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1251 bp
Description
Full length Clone DNA of Mouse histone aminotransferase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

KAT1 / HAT1 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

2410071B14Rik cDNA ORF Clone, Mouse; AA536933 cDNA ORF Clone, Mouse; Hat-1 cDNA ORF Clone, Mouse; KAT1 cDNA ORF Clone, Mouse

KAT1 / HAT1 Background Information

Histone acetyltransferase HAT1 can up regulate cell apoptosis. The dysfunction of apoptosis is one of the factors contributing to lung cancer (LC) growth. Up regulation of HAT1 expression in LCCs can induce LCCs apoptosis, which may be a potential novel therapy for the treatment of LC. KAT8 or HAT1 regulate HBV replication and may be potential drug targets of anti-HBV therapy. HAT1 played an important role in esophageal carcinoma and that it could be a novel EC therapeutic target.
Full Name
histone acetyltransferase 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait