Быстрый заказ

Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse HAPLN1 Информация о продукте «Клон cDNA»
Размер кДНК:1071bp
Описание кДНК:Full length Clone DNA of Mus musculus hyaluronan and proteoglycan link protein 1 with N terminal Flag tag.
Синоним гена:LP, CLP, LP-1, Crtl1, Crtl1l, BB099155
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52939-ACGRBS15400
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52939-ACRRBS15400
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52939-ANGRBS15400
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52939-ANRRBS15400
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52939-CFRBS13340
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52939-CHRBS13340
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52939-CMRBS13340
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52939-CYRBS13340
Мышь HAPLN1 Джин клон кДНК в вектор клонированияMG52939-GRBS5130
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52939-NFRBS13340
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52939-NHRBS13340
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52939-NMRBS13340
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52939-NYRBS13340
Мышь HAPLN1 Джин ORF экспрессии кДНК клона плазмидыMG52939-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Hyaluronan (HA) is a high MW glycosaminoglycan significantly involved in the formation and stability of extracellular matrix via its association with specific HA-binding proteins. HAPLN1, also known as CRTL1 (Cartilage Link Protein 1, cLP ) and link protein, is a member of HA-binding protein (hyaladherins) family, and contains a common structural domain of about 100 amino acids that is termed a Link module with two α-helices and two antiparallel β-sheets. HAPLN1/CRTL1 stabilizes the interaction between hyaluronan (HA) and versican, two extracellular matrix components essential for cardiac development. Link module superfamily can be divided into three subgroups, and the HAPLN family are C domain-type proteins that have an extended structure with one N-terminal V-type Ig-like domain followed by two link modules. In cartilage, aggrecan forms - cLP stabilized aggregates with HA that provides the tissue with its load bearing properties. HAPLN1 is a component of follicular matrix, was shown to enhance cumulus-oocyte complex (COC) expansion in vitro. HAPLN1 may promote periovulatory granulosa cell survival, which would facilitate their differentiation into luteal cells.

  • Sun GW, et al. (2003) Follicle-stimulating hormone and insulin-like growth factor I synergistically induce up-regulation of cartilage link protein (Crtl1) via activation of phosphatidylinositol-dependent kinase/Akt in rat granulosa cells. Endocrinology. 144(3): 793-801.
  • Wirrig EE, et al. (2007) Cartilage link protein 1 (Crtl1), an extracellular matrix component playing an important role in heart development. Dev Biol. 310(2): 291-303.
  • Liu J, et al. (2010) Periovulatory expression of hyaluronan and proteoglycan link protein 1 (Hapln1) in the rat ovary: hormonal regulation and potential function. Mol Endocrinol. 24(6): 1203-17.
  • Size / Price
    Каталог: MG52939-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.