Быстрый заказ

Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse H1F0 Информация о продукте «Клон cDNA»
Размер кДНК:585bp
Описание кДНК:Full length Clone DNA of Mus musculus H1 histone family, member 0 with C terminal Flag tag.
Синоним гена:H1fv, H1(0), MGC19309, MGC98218, MGC117919, D130017D06Rik, H1f0
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51008-ACGRBS15400
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51008-ACRRBS15400
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51008-ANGRBS15400
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51008-ANRRBS15400
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51008-CFRBS13340
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51008-CHRBS13340
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51008-CMRBS13340
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51008-CYRBS13340
Мышь H1F0/Histone H1 Джин клон кДНК в вектор клонированияMG51008-GRBS5130
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51008-NFRBS13340
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51008-NHRBS13340
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51008-NMRBS13340
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51008-NYRBS13340
Мышь H1F0/Histone H1 Джин ORF экспрессии кДНК клона плазмидыMG51008-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

H1 histone family, member 0 (H1F0) is a member of the H1 histone family of nuclear proteins which are a component of chromatin in eukaryotic cells. It's involved in maintaining the structure of chromatin by packing the "beads on a string" sub-structure into a high order structure. The lysine-rich H1 histone family in mammals includes eleven members. In higher eukaryotes all H1 variants have the same general structure, consisting of a central conserved globular domain and less conserved N-terminal and C-terminal tails. These tails are moderately conserved among species, but differ among variants, suggesting a specific function for each H1 variant. Studies on the role of particular subtypes at specific developmental stages in lower eukaryotes, but also in vertebrates suggest that specific subtypes of H1 participate in particular systems of gene regulation. 

  • Ramakrishnan V, et al. (1993) Crystal structure of globular domain of histone H5 and its implications for nucleosome binding. Nature. 362 (6417): 219-23.
  • Happel N, et al. (2009) Histone H1 and its isoforms: contribution to chromatin structure and function. Gene. 431 (1-2): 1-12.
  • Izzo A, et al. (2008) The histone H1 family: specific members, specific functions. Biol Chem. 389 (4): 333-43.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.