After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GTF2E2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_026584.3
Размер кДНК:879bp
Описание кДНК:Full length Clone DNA of Mus musculus general transcription factor II E, polypeptide 2 (beta subunit) with N terminal HA tag.
Синоним гена:34kDa, AI462509, C330006J08Rik
Виды:Mouse
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52004-ACGRBS15400
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52004-ACRRBS15400
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52004-ANGRBS15400
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52004-ANRRBS15400
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52004-CFRBS13340
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52004-CHRBS13340
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52004-CMRBS13340
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52004-CYRBS13340
Мышь GTF2E2 Джин клон кДНК в вектор клонированияMG52004-GRBS5130
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52004-NFRBS13340
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52004-NHRBS13340
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52004-NMRBS13340
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52004-NYRBS13340
Мышь GTF2E2 Джин ORF экспрессии кДНК клона плазмидыMG52004-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52004-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».