After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GRPEL2 Информация о продукте «Клон cDNA»
Размер кДНК:675bp
Описание кДНК:Full length Clone DNA of Mus musculus GrpE-like 2, mitochondrial with N terminal HA tag.
Синоним гена:mt-GrpE#2, mt-Grpel2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51998-ACGRBS15400
Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51998-ACRRBS15400
Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51998-CFRBS13340
Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51998-CHRBS13340
Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51998-CMRBS13340
Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51998-CYRBS13340
Мышь GRPEL2 Джин клон кДНК в вектор клонированияMG51998-GRBS5130
Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51998-NFRBS13340
Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51998-NHRBS13340
Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51998-NMRBS13340
Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51998-NYRBS13340
Мышь GRPEL2 Джин ORF экспрессии кДНК клона плазмидыMG51998-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51998-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.