Быстрый заказ

Text Size:AAA

Mouse GREM2 ORF mammalian expression plasmid, N-His tag

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GREM2 Информация о продукте «Клон cDNA»
Размер кДНК:507bp
Описание кДНК:Full length Clone DNA of Mus musculus gremlin 2 homolog, cysteine knot superfamily (Xenopus laevis) with N terminal His tag.
Синоним гена:Prdc, Gremlin2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Каталог: MG50123-NH
Цена по прейскуранту:   (Save )
Цена:      [How to order]
 Инструкции по доставке
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.