Быстрый заказ

Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GPR37L1 Информация о продукте «Клон cDNA»
Размер кДНК:1446bp
Описание кДНК:Full length Clone DNA of Mus musculus G protein-coupled receptor 37-like 1 with N terminal Myc tag.
Синоним гена:CAG-18, D0Kist8, AW047233
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51449-ACGRBS15400
Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51449-ACRRBS15400
Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51449-CFRBS13340
Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51449-CHRBS13340
Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51449-CMRBS13340
Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51449-CYRBS13340
Мышь GPR37L1 Джин клон кДНК в вектор клонированияMG51449-GRBS5130
Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51449-NFRBS13340
Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51449-NHRBS13340
Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51449-NMRBS13340
Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51449-NYRBS13340
Мышь GPR37L1 Джин ORF экспрессии кДНК клона плазмидыMG51449-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51449-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.