Быстрый заказ

Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь GPR110 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_133776.2
Размер кДНК:2727bp
Описание кДНК:Full length Clone DNA of Mus musculus G protein-coupled receptor 110 with N terminal His tag.
Синоним гена:KPG_009, 5031409J19Rik
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with GPR110 qPCR primers for gene expression analysis, MP201283 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51392-ACGRBS22240
Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51392-ACRRBS22240
Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51392-CFRBS20190
Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51392-CHRBS20190
Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51392-CMRBS20190
Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51392-CYRBS20190
Мышь GPR110 Джин клон кДНК в вектор клонированияMG51392-GRBS5130
Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51392-NFRBS20190
Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51392-NHRBS20190
Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51392-NMRBS20190
Мышь GPR110 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51392-NYRBS20190
Мышь GPR110 Джин ORF экспрессии кДНК клона плазмидыMG51392-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51392-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».