Быстрый заказ

Text Size:AAA

Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GPC6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001079844.1
Размер кДНК:1698bp
Описание кДНК:Full length Clone DNA of Mus musculus glypican 6 with N terminal His tag.
Синоним гена:AI480529, MGC32221, 6720429C22Rik, Gpc6
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50742-ACGRBS16760
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50742-ACRRBS16760
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50742-CFRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50742-CHRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50742-CMRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50742-CYRBS14710
Мышь Glypican 6/GPC6 Джин клон кДНК в вектор клонированияMG50742-MRBS5130
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50742-NFRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50742-NHRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50742-NMRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50742-NYRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмидыMG50742-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50742-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».