After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GPC6 Информация о продукте «Клон cDNA»
Размер кДНК:1698bp
Описание кДНК:Full length Clone DNA of Mus musculus glypican 6 with N terminal His tag.
Синоним гена:AI480529, MGC32221, 6720429C22Rik, Gpc6
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50742-ACGRBS16760
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50742-ACRRBS16760
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50742-CFRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50742-CHRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50742-CMRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50742-CYRBS14710
Мышь Glypican 6/GPC6 Джин клон кДНК в вектор клонированияMG50742-MRBS5130
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50742-NFRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50742-NHRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50742-NMRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50742-NYRBS14710
Мышь Glypican 6/GPC6 Джин ORF экспрессии кДНК клона плазмидыMG50742-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50742-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.