Glypican 3 cDNA ORF Clone, Mouse, untagged

Cat: MG50989-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Glypican 3 Reagents

CRO Services

Product recommended


All Glypican 3 Reagents

Glypican 3 cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1740 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse glypican 3.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.74kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Glypican 3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Glypican 3 cDNA ORF Clone, Mouse, untagged Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5613

Glypican 3 cDNA ORF Clone, Mouse, untagged Alternative Names

OCI-5 cDNA ORF Clone, Mouse

Glypican 3 Background Information

Glypican-3, also known as Intestinal protein OCI-5, GPC3, and OCI5, is a member of the glypican family. It belongs to the glypican family and is highly expressed in lung, liver, and kidney. It is a heparan sulfate proteoglycan, which is overexpressed in various neoplasms such as hepatocellular carcinoma, malignant melanoma, and testicular yolk sac tumor, and plays an important role in cell growth and differentiation. GPC3 function is tissue dependent. In some tissues, GPC3 acts as a tumor suppressor gene, whereas in others, it acts as an oncofetal protein. Studies have shown that GPC3 is a reliable marker for hepatocellular carcinoma. The sensitivity and specificity exceeds both alpha-fetoprotein and hepatocyte-paraffin1. GPC3 immunohistochemistry can aid in the differentiation of testicular germ cell tumors, being expressed in all yolk sac tumors but not in seminomas. GPC3 expression has also been identified in some squamous cell carcinomas of the lung and clear cell carcinomas of the ovary. The role of GPC3 in melanomas is still controversial. Thus, Glypican-3 is currently regarded as a tumor marker and potential target for immunotherapy.Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy
Full Name
glypican 3
References
  • Kandil DH, et al. (2009) Glypican-3: a novel diagnostic marker for hepatocellular carcinoma and more. Adv Anat Pathol. 16(2): 125-9.
  • Maeda D, et al. (2009) Glypican-3 expression in clear cell adenocarcinoma of the ovary. Mod Pathol. 22(6): 824-32.
  • Glypican 3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Glypican 3 cDNA ORF Clone in Cloning Vector, Mouse MG50989-G
    Glypican 3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50989-ACG
    Glypican 3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50989-ACGLN
    Glypican 3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50989-ACR
    Glypican 3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50989-CF
    Glypican 3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50989-NF
    Glypican 3 cDNA ORF Clone, Mouse, C-His tag MG50989-CH
    Glypican 3 cDNA ORF Clone, Mouse, N-His tag MG50989-NH
    Glypican 3 cDNA ORF Clone, Mouse, C-HA tag MG50989-CY
    Glypican 3 cDNA ORF Clone, Mouse, N-HA tag MG50989-NY
    Glypican 3 cDNA ORF Clone, Mouse, C-Myc tag MG50989-CM
    Glypican 3 cDNA ORF Clone, Mouse, N-Myc tag MG50989-NM
    Glypican 3 qPCR Primer Pairs, Mouse MP200955

    Glypican 3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Glypican 3 cDNA ORF Clone, Human, untagged HG10088-UT
    Glypican 3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10088-ACGLN
    Glypican 3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10088-ACG
    Glypican 3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10088-ACR
    Glypican 3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10088-CF
    Glypican 3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10088-NF
    Glypican 3 cDNA ORF Clone, Human, C-His tag HG10088-CH
    Glypican 3 cDNA ORF Clone, Human, C-HA tag HG10088-CY
    Glypican 3 cDNA ORF Clone, Human, C-Myc tag HG10088-CM
    Glypican 3 qPCR Primer Pairs, Human HP100172
    info info
    添加购物车成功! 添加购物车失败!