GP9/GPIX/CD42a cDNA ORF Clone, Mouse, untagged

Cat: MG50720-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GP9/GPIX/CD42a Reagents

CRO Services

Product recommended


All GP9/GPIX/CD42a Reagents

GP9/GPIX/CD42a cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
534 bp
Description
Full length Clone DNA of Mouse glycoprotein 9 (platelet).

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GP9/GPIX/CD42a cDNA ORF Clone, Mouse, untagged Alternative Names

Cd42 cDNA ORF Clone, Mouse;GPIX cDNA ORF Clone, Mouse

GP9/GPIX/CD42a Background Information

Full Name
glycoprotein IX (platelet)

GP9/GPIX/CD42a cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GP9/GPIX/CD42a cDNA ORF Clone in Cloning Vector, Mouse MG50720-G
GP9/GPIX/CD42a cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50720-ACG
GP9/GPIX/CD42a Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50720-ACGLN
GP9/GPIX/CD42a cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50720-ACR
GP9/GPIX/CD42a cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50720-CF
GP9/GPIX/CD42a cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50720-NF
GP9/GPIX/CD42a cDNA ORF Clone, Mouse, C-His tag MG50720-CH
GP9/GPIX/CD42a cDNA ORF Clone, Mouse, N-His tag MG50720-NH
GP9/GPIX/CD42a cDNA ORF Clone, Mouse, C-HA tag MG50720-CY
GP9/GPIX/CD42a cDNA ORF Clone, Mouse, N-HA tag MG50720-NY
GP9/GPIX/CD42a cDNA ORF Clone, Mouse, C-Myc tag MG50720-CM
GP9/GPIX/CD42a cDNA ORF Clone, Mouse, N-Myc tag MG50720-NM
GP9/GPIX/CD42a qPCR Primer Pairs, Mouse MP200695

GP9/GPIX/CD42a cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GP9/GPIX/CD42a cDNA ORF Clone in Cloning Vector, Human HG10251-M
GP9/GPIX/CD42a cDNA ORF Clone, Human, untagged HG10251-UT
GP9/GPIX/CD42a Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10251-ACGLN
GP9/GPIX/CD42a cDNA ORF Clone, Human, C-GFPSpark® tag HG10251-ACG
GP9/GPIX/CD42a cDNA ORF Clone, Human, C-OFPSpark® tag HG10251-ACR
GP9/GPIX/CD42a cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10251-CF
GP9/GPIX/CD42a cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10251-NF
GP9/GPIX/CD42a cDNA ORF Clone, Human, C-His tag HG10251-CH
GP9/GPIX/CD42a cDNA ORF Clone, Human, N-His tag HG10251-NH
GP9/GPIX/CD42a cDNA ORF Clone, Human, C-HA tag HG10251-CY
GP9/GPIX/CD42a cDNA ORF Clone, Human, N-HA tag HG10251-NY
GP9/GPIX/CD42a cDNA ORF Clone, Human, C-Myc tag HG10251-CM
GP9/GPIX/CD42a cDNA ORF Clone, Human, N-Myc tag HG10251-NM
GP9/GPIX/CD42a qPCR Primer Pairs, Human HP100301
info info
添加购物车成功! 添加购物车失败!