After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GP1BB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001001999.1
Размер кДНК:645bp
Описание кДНК:Full length Clone DNA of Mus musculus glycoprotein Ib, beta polypeptide with N terminal Flag tag.
Синоним гена:Gp1bb
Виды:Mouse
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51075-ACGRBS15400
Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51075-ACRRBS15400
Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51075-CFRBS13340
Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51075-CHRBS13340
Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51075-CMRBS13340
Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51075-CYRBS13340
Мышь GP1BB/CD42c Джин клон кДНК в вектор клонированияMG51075-GRBS5130
Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51075-NFRBS13340
Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51075-NHRBS13340
Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51075-NMRBS13340
Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51075-NYRBS13340
Мышь GP1BB/CD42c Джин ORF экспрессии кДНК клона плазмидыMG51075-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Platelet glycoprotein Ib (GPIb) complex is best known as a major platelet receptor for von Willebrand factor essential for platelet adhesion under high shear conditions found in arteries and in thrombosis. The GPIb complex is composed of GPIb alpha (Platelet glycoprotein Ib alpha chain) covalently attached to GPIb beta (Platelet glycoprotein Ib beta chain) and noncovalently complexed with GPIX and GPV. GPIb-beta, also known as GP1BB, CD42b-beta and CD42c, is single-pass type I membrane protein expressed in heart and brain, which is a critical component of the von Willebrand factor (vWF) receptor. The cysteine knot region of GPIb beta in the N terminus is critical for the conformation of GPIb beta that interacts with GPIX. The precursor of GP1BB is synthesized from a 1.0 kb mRNA expressed in plateletes and megakaryocytes. GPIb is a heterodimeric transmembrane protein consisting of a disulfide-linked 140 kD alpha chain and 22 kD beta chain. GPIb alpha chain provides the vWF binding site, and GPIb beta chain contributes to surface expression of the receptor and participates in transmembrane signaling through phosphorylation of its intracellular domain. GP1BB is part of the GPIb-V-IX system that constitutes the receptor for von Willebrand factor (vWF), and mediates platelet adhesion in the arterial circulation. Defects in GP1BB are a cause of Bernard-Soulier syndrome (BSS), also known as giant platelet disease (GPD). BSS patients have unusually large platelets and have a clinical bleeding tendency.

Ссылки
  • Kenny D, et al. (2002) The cysteine knot of platelet glycoprotein Ib beta (GPIb beta) is critical for the interaction of GPIb beta with GPIX. Blood. 99(12): 4428-33.
  • Tang J,et al. (2004) Mutation in the leucine-rich repeat C-flanking region of platelet glycoprotein Ib beta impairs assembly of von Willebrand factor receptor. Thromb Haemost. 92(1): 75-88.
  • Vanhoorelbeke K, et al. (2007) Inhibition of platelet glycoprotein Ib and its antithrombotic potential. Curr Pharm Des. 13(26): 2684-97.
  • Clemetson KJ, et al. (2008) Platelet GPIb complex as a target for anti-thrombotic drug development. Thromb Haemost. 99(3): 473-9.
  • Size / Price
    Каталог: MG51075-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».