GMPR cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

GMPR cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1038 bp
Description
Full length Clone DNA of Mouse guanosine monophosphate reductase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GMPR cDNA ORF Clone, Mouse, N-His tag: Alternative Names

2310004P21Rik cDNA ORF Clone, Mouse; AV028449 cDNA ORF Clone, Mouse

GMPR Background Information

GMPR, also known as GMPR1, belongs to the IMPDH/GMPR family.This familyofenzymesincludesIMP dehydrogenaseandGMP reductase. These enzymes are involved inpurine metabolism and adopt aTIM barrelstructure. GMPR is an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. GMPR functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.
Full Name
guanosine monophosphate reductase
References
  • Deng Y., et al.,(2002), NADPH-dependent GMP reductase isoenzyme of human (GMPR2). Expression, purification, and kinetic properties. Int. J. Biochem. Cell Biol. 34:1035-1050.
  • Zhang J., et al., (2003), Cloning and functional characterization of GMPR2, a novel human guanosine monophosphate reductase, which promotes the monocytic differentiation of HL-60 leukemia cells.J. Cancer Res. Clin. Oncol. 129:76-83.
  • Ivens A.C., et al.,(2005), The genome of the kinetoplastid parasite, Leishmania major.Science 309:436-442.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait