Быстрый заказ

Text Size:AAA

Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GMPR Информация о продукте «Клон cDNA»
Размер кДНК:1038bp
Описание кДНК:Full length Clone DNA of Mus musculus guanosine monophosphate reductase with N terminal His tag.
Синоним гена:AV028449, 2310004P21Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51395-ACGRBS15400
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51395-ACRRBS15400
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51395-ANGRBS15400
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51395-ANRRBS15400
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51395-CFRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51395-CHRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51395-CMRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51395-CYRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51395-NFRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51395-NHRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51395-NMRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51395-NYRBS13340
Мышь GMPR / GMPR1 Джин клон кДНК в вектор клонированияMG51395-URBS5130
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмидыMG51395-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

GMPR, also known as GMPR1, belongs to the IMPDH/GMPR family. This family of enzymes includes IMP dehydrogenase and GMP reductase. These enzymes are involved in purine metabolism and adopt a TIM barrel structure. GMPR is an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. GMPR functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.

Size / Price
Каталог: MG51395-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.