After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GMPR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_025508.4
Размер кДНК:1038bp
Описание кДНК:Full length Clone DNA of Mus musculus guanosine monophosphate reductase with N terminal His tag.
Синоним гена:AV028449, 2310004P21Rik
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51395-ACGRBS15400
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51395-ACRRBS15400
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51395-ANGRBS15400
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51395-ANRRBS15400
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51395-CFRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51395-CHRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51395-CMRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51395-CYRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51395-NFRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51395-NHRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51395-NMRBS13340
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51395-NYRBS13340
Мышь GMPR / GMPR1 Джин клон кДНК в вектор клонированияMG51395-URBS5130
Мышь GMPR / GMPR1 Джин ORF экспрессии кДНК клона плазмидыMG51395-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

GMPR, also known as GMPR1, belongs to the IMPDH/GMPR family. This family of enzymes includes IMP dehydrogenase and GMP reductase. These enzymes are involved in purine metabolism and adopt a TIM barrel structure. GMPR is an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. GMPR functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.

Size / Price
Каталог: MG51395-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».