After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GLRX Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_053108.4
Размер кДНК:324bp
Описание кДНК:Full length Clone DNA of Mus musculus glutaredoxin with N terminal Flag tag.
Синоним гена:Grx1, Glrx1, TTase, C86710, D13Wsu156e
Виды:Mouse
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52947-ACGRBS15400
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52947-ACRRBS15400
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52947-ANGRBS15400
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52947-ANRRBS15400
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52947-CFRBS13340
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52947-CHRBS13340
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52947-CMRBS13340
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52947-CYRBS13340
Мышь glutaredoxin-1 / GRX1 / GLRX Джин клон кДНК в вектор клонированияMG52947-GRBS5130
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52947-NFRBS13340
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52947-NHRBS13340
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52947-NMRBS13340
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52947-NYRBS13340
Мышь glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмидыMG52947-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Glutaredoxin-1, also known as GRX1 and GLRX, belongs to the glutaredoxin family. Glutaredoxins are small redox enzymes that use glutathione as a cofactor. Glutaredoxins are oxidized by substrates, and reduced non-enzymatically by glutathione. Glutaredoxin-1 functions as an electron carrier in the glutathione-dependent synthesis of deoxyribonucleotides by the enzyme ribonucleotide reductase. Glutaredoxin-1 exists in either a reduced or an oxidized form. Glutaredoxins function as electron carriers in the glutathione-dependent synthesis of deoxyribonucleotides by the enzymeribonucleotide reductase.

Ссылки
  • Holmgren A. et al., 1988, FEMS Microbiol Rev. 4 (4): 271-97.
  • Holmgren A. 1988, Biochem Soc Trans. 16 (2): 95-6.
  • Holmgren A. 1989, J Biol Chem. 264 (24): 13963-6.
  • Size / Price
    Каталог: MG52947-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».