After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse GJB2 Информация о продукте «Клон cDNA»
Размер кДНК:681 bp
Описание кДНК:Full length Clone DNA of Mus musculus gap junction protein, beta 2
Синоним гена:AI325222,Cnx26,Cx26,Gjb-2
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51645-ACGRBS15396
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51645-ACRRBS15396
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51645-ANGRBS15396
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51645-ANRRBS15396
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51645-CFRBS5132
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51645-CHRBS13343
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51645-CMRBS13343
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51645-CYRBS13343
Mouse GJB2 Gene cDNA clone plasmidMG51645-GRBS5130
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51645-NFRBS13343
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51645-NHRBS13343
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51645-NMRBS13343
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51645-NYRBS13343
Мышь GJB2 Джин клон кДНК в вектор клонированияMG51645-URBS5132
Мышь GJB2 Джин ORF экспрессии кДНК клона плазмидыMG51645-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51645-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.