Быстрый заказ

Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

  • Cynomolgus LOC101926731 Gene Plasmid Map 5628
ПаспортОбзорыСвязанные продуктыПротоколы
Мышь GID8 Информация о продукте «Клон cDNA»
Размер кДНК:729 bp
Описание кДНК:Full length Clone DNA of Mus musculus GID complex subunit 8 homolog (S. cerevisiae) with N terminal HA tag.
Синоним гена:Twa1, AI451474, 2310003C23Rik, 4833420G11Rik
Участок рестрикции:KpnI + XbaI(6kb+0.73kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with GID8 qPCR primers for gene expression analysis, MP201873 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52000-ACGRBS15400
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52000-ACRRBS15400
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52000-ANGRBS15400
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52000-ANRRBS15400
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52000-CFRBS13340
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52000-CHRBS13340
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52000-CMRBS13340
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52000-CYRBS13340
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52000-NFRBS13340
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52000-NHRBS13340
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52000-NMRBS13340
Мышь GID8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52000-NYRBS13340
Человек GID8 Джин клон кДНК в вектор клонированияMG52000-URBS5130
Мышь GID8 Джин ORF экспрессии кДНК клона плазмидыMG52000-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52000-NY
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Добавить в корзинуЗапрос по оптовому заказу

Datasheet & Documentation

Contact Us
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.