VISTA cDNA ORF Clone, Mouse, C-Myc tag

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

VISTA cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
930 bp
Description
Full length Clone DNA of Mouse RIKEN cDNA 4632428N05 gene with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

VISTA cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

Dies1 cDNA ORF Clone, Mouse; PD-1H cDNA ORF Clone, Mouse; VISTA cDNA ORF Clone, Mouse

VISTA Background Information

VSIR, or V-set immunoregulatory receptor, could be involved in the pathogenesis of chronic rhinosinusitis with nasal polyps.V-domain Immunoglobulin Suppressor of T cell Activation (VISTA) is an inhibitory immune-checkpoint molecule that suppresses CD4+ and CD8+ T cell activation when expressed on antigen-presenting cells.
Full Name
V-set immunoregulatory receptor

VISTA cDNA ORF Clone, Rat, Related Products

VISTA cDNA ORF Clone, Cynomolgus, Related Products

VISTA cDNA ORF Clone, Rhesus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait